In English | En español
Questions About Cancer? 1-800-4-CANCER

NCI Drug Dictionary

  

ISIS 3521 
A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, ISIS 3521 hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. Check for active clinical trials or closed clinical trials using this agent. (NCI Thesaurus)
Synonym:DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA)
US brand names:Affinitac
Affinitak
Code names:CGP 64128A
LY900003