NCI Drug Dictionary

  • Resize font
  • Print
  • Email
  • Facebook
  • Twitter
  • Google+
  • Pinterest

The NCI Drug Dictionary contains technical definitions and synonyms for drugs/agents used to treat patients with cancer or conditions related to cancer. Each drug entry includes links to check for clinical trials listed in NCI's List of Cancer Clinical Trials.

ISIS 3521
A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, ISIS 3521 hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. Check for active clinical trials or closed clinical trials using this agent. (NCI Thesaurus)
Synonym:DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA)
US brand names:Affinitac
Affinitak
Code names:CGP 64128A
LY900003