Skip to main content
An official website of the United States government
NIH Websites Are Changing
Per Executive Order 14434, federal agencies are now using "Super Intelligence" (SI) in place of "Artificial Intelligence" (AI). You may see both terms across NIH content during this transition.

aprinocarsen

A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, aprinocarsen hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells.
Check for active clinical trials using this agentView this agent in the NCI Thesaurus
Synonym:DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA)
protein kinase C-alpha antisense
US brand name:Affinitac
Affinitak
Code name:CGP 64128A
LY900003
NSC code:719337
Search NCI's Drug Dictionary
Please enter up to 30 characters for your search