aprinocarsen
A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, aprinocarsen hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells.
| Synonym: | DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA) protein kinase C-alpha antisense |
|---|---|
| US brand name: | Affinitac Affinitak |
| Code name: | CGP 64128A LY900003 |
| NSC code: | 719337 |