Government Funding Lapse
Because of a lapse in government funding, the information on this website may not be up to date, transactions submitted via the website may not be processed, and the agency may not be able to respond to inquiries until appropriations are enacted.

The NIH Clinical Center (the research hospital of NIH) is open. For more details about its operating status, please visit cc.nih.gov.

Updates regarding government operating status and resumption of normal operations can be found at opm.gov.

aprinocarsen

A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, aprinocarsen hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells.

Check for active clinical trials using this agent View this agent in the NCI Thesaurus

Synonym:	DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA) protein kinase C-alpha antisense
US brand name:	Affinitac Affinitak
Code name:	CGP 64128A LY900003
NSC code:	719337

aprinocarsen

Search NCI's Drug Dictionary